| Sign In | Join Free | My benadorassociates.com |
|
Brand Name : GDSBio
Model Number : K003-A, K003-B, K003-C, K003-D
Certification : /
Place of Origin : China
MOQ : 1Bag
Price : /
Payment Terms : L/C, D/A, D/P, T/T, Western Union, MoneyGram
Supply Ability : 100 Bag/Bags Per Day
Delivery Time : 8 work days
Packaging Details : small package or bulk distribute or OEM
Cat. No. : K003-A, K003-B, K003-C, K003-D
Concentration : 96 rxns
Appearance : colourless
Group : NGS Library Construction
Activity : Pass
Amplification capability : Good
Logo Printing : With Logo Printing
Transport Package : Packing
Production Capacity : 100 Bag/Bags Per Day
Storage Conditions : Store at -20°C
NGS Library UDI UMI Adapters Primers for Illumina K003-A, K003-B, K003-C, K003-D
【Product Name】
UDI UMI Adapters Primers for Illumina
【Cat. No. & Spec.】
K003-A, K003-B, K003-C, K003-D; 96 rxns each
【Product Description】
#K003 UDI UMI Adapter has a 6 nt random complementary sequence, allowing for the addition of 6 nt UMI (Unique Molecular Identifiers) at both ends of the library after adapters ligation. The UMI allows multiplex analysis for multiple samples simultaneously, reducing the detection rate of false positive variants and improving the sensitivity of detection for low frequency mutations. The pre-mixed 96 UDI Primers have 8 nt specific matching i5 and i7 UDI (Unique Dual Index) sequences, which can be independently double-checked by library amplification to meet the high-throughput sequencing mixing requirements and greatly reduce the sample index misassignment.
【Storage Condition & Shelf Life】
All reagents should be stored at -20°C. The product is valid for 12 months.
Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.
【Scope of application】
This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.
【Components】
| Component | K003-A (96rxns) | K003-B (96rxns) | K003-C (96rxns) | K003-D (96rxns) |
| UMI Adapter | 480μl | 480μl | 480μl | 480μl |
| UDI Primer (UDI 001 - UDI 024) | 20μl/each
| |||
| UDI Primer (UDI 025 - UDI 048) | 20μl/each
| |||
| UDI Primer (UDI 049 - UDI 072) | 20μl/each
| |||
| UDI Primer (UDI 073 - UDI 096) | 20μl/each
|
Sequence Information
UMI Adapter:
5’ -ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNN-s-T-3’
5’-p-NNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTC-3’
N indicates that each Adapter has a 6 nt random complementary UMI sequence, -s- indicates a thio modification, and -p- indicates a phosphorylation modification.
UDI i5 PCR Primer:
5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT
C-3’
UDI i7 PCR Primer:
5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’
[i5] refers to the 8 nt i5 index sequence and [i7] refers to the 8 nt i7 index sequence.
The i7 index in the table below is the index sequence in the primers, and the index sequence is reverse complementary when input/sequencing in the sample sheet.


GDSBio has a complete product line. With PCR technology as the core, focusing on molecular biology techniques such as ordinary PCR, fluorescence quantitative PCR, nucleic acid electrophoresis, nucleic acid purification, it has developed reagents for molecular biology research and diagnosis, and completed the layout of the whole industrial chain from molecular biology reagents, medical lab supplies to specialized services.

Dongsheng Biotech offers different series of products to help you achieve PCR success. For enzymes, our Taq Polymerase, HS Taq DNA Polymerase, FS Taq DNA Polymerase, Pfu DNA Polymerase and Fusion Pfu DNA Polymerase provide high fidelity, efficient, sensitivity PCR performance. We also have Long Taq DNA Polymerase for long PCR performance.

|
|
PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D Images |