Sign In | Join Free | My benadorassociates.com
China Guangzhou Dongsheng Biotech Co., Ltd logo
Guangzhou Dongsheng Biotech Co., Ltd
Professional Supplier of PCR & NGS Reagents
Active Member

4 Years

Home > NGS Library Construction >

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D

Guangzhou Dongsheng Biotech Co., Ltd
Contact Now

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D

Brand Name : GDSBio

Model Number : K003-A, K003-B, K003-C, K003-D

Certification : /

Place of Origin : China

MOQ : 1Bag

Price : /

Payment Terms : L/C, D/A, D/P, T/T, Western Union, MoneyGram

Supply Ability : 100 Bag/Bags Per Day

Delivery Time : 8 work days

Packaging Details : small package or bulk distribute or OEM

Cat. No. : K003-A, K003-B, K003-C, K003-D

Concentration : 96 rxns

Appearance : colourless

Group : NGS Library Construction

Activity : Pass

Amplification capability : Good

Logo Printing : With Logo Printing

Transport Package : Packing

Production Capacity : 100 Bag/Bags Per Day

Storage Conditions : Store at -20°C

Contact Now

NGS Library UDI UMI Adapters Primers for Illumina K003-A, K003-B, K003-C, K003-D

【Product Name】

UDI UMI Adapters Primers for Illumina

【Cat. No. & Spec.】

K003-A, K003-B, K003-C, K003-D; 96 rxns each

【Product Description】

#K003 UDI UMI Adapter has a 6 nt random complementary sequence, allowing for the addition of 6 nt UMI (Unique Molecular Identifiers) at both ends of the library after adapters ligation. The UMI allows multiplex analysis for multiple samples simultaneously, reducing the detection rate of false positive variants and improving the sensitivity of detection for low frequency mutations. The pre-mixed 96 UDI Primers have 8 nt specific matching i5 and i7 UDI (Unique Dual Index) sequences, which can be independently double-checked by library amplification to meet the high-throughput sequencing mixing requirements and greatly reduce the sample index misassignment.

【Storage Condition & Shelf Life】

All reagents should be stored at -20°C. The product is valid for 12 months.

Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.

【Scope of application】

This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.

【Components】

Component

K003-A

(96rxns)

K003-B

(96rxns)

K003-C

(96rxns)

K003-D

(96rxns)

UMI Adapter 480μl 480μl 480μl 480μl

UDI Primer

(UDI 001 - UDI 024)

20μl/each

UDI Primer

(UDI 025 - UDI 048)

20μl/each

UDI Primer

(UDI 049 - UDI 072)

20μl/each

UDI Primer

(UDI 073 - UDI 096)

20μl/each

Sequence Information

UMI Adapter:

5’ -ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNN-s-T-3’

5’-p-NNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTC-3’

N indicates that each Adapter has a 6 nt random complementary UMI sequence, -s- indicates a thio modification, and -p- indicates a phosphorylation modification.

UDI i5 PCR Primer:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT

C-3’

UDI i7 PCR Primer:

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’

[i5] refers to the 8 nt i5 index sequence and [i7] refers to the 8 nt i7 index sequence.

The i7 index in the table below is the index sequence in the primers, and the index sequence is reverse complementary when input/sequencing in the sample sheet.

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D

GDSBio has a complete product line. With PCR technology as the core, focusing on molecular biology techniques such as ordinary PCR, fluorescence quantitative PCR, nucleic acid electrophoresis, nucleic acid purification, it has developed reagents for molecular biology research and diagnosis, and completed the layout of the whole industrial chain from molecular biology reagents, medical lab supplies to specialized services.

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D
Dongsheng Biotech offers different series of products to help you achieve PCR success. For enzymes, our Taq Polymerase, HS Taq DNA Polymerase, FS Taq DNA Polymerase, Pfu DNA Polymerase and Fusion Pfu DNA Polymerase provide high fidelity, efficient, sensitivity PCR performance. We also have Long Taq DNA Polymerase for long PCR performance.

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D


Product Tags:

Illumina K003-B NGS Library Construction

      

Illumina K003-D NGS Library Construction

      
Quality PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D for sale

PCR NGS Library Construction UDI UMI Adapters Primers For Illumina K003-A K003-B K003-C K003-D Images

Inquiry Cart 0
Send your message to this supplier
 
*From:
*To: Guangzhou Dongsheng Biotech Co., Ltd
*Subject:
*Message:
Characters Remaining: (0/3000)