| Sign In | Join Free | My benadorassociates.com |
|
Brand Name : GDSBio
Model Number : K002-B
Certification : ISO9001, ISO13485
Place of Origin : China
MOQ : 1 Kit
Price : /
Payment Terms : L/C, D/A, D/P, T/T, Western Union, MoneyGram
Supply Ability : 1000 Kits per Day
Delivery Time : 8 work days
Packaging Details : small package or bulk distribute or OEM
Catalog No : V9001
Size : 48 tests/kit, 96 tests/kit
Sample Type : DNA
Platform : Illumina
Storage Condition : -20°C
Shelf Life : 12 months
Multiplex Oligos 2 for Illumina
【Product Name】
Multiplex Oligos 2 for Illumina
【Cat. No./Spec.】
K002-B/192 rxns
【Product Description】
#K002-B Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-A Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.
【Storage Condition & Shelf Life】
All reagents should be stored at -20°C. The product is valid for 12 months.
Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.
【Scope of application】
This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.
【Components】
| Component | Specification (192rxns) |
| Adapter | 960μl |
| i5 PCR Primer | Specification |
| KP509 | 90μl |
| KP510 | 90μl |
| KP511 | 90μl |
| KP512 | 90μl |
| KP513 | 90μl |
| KP514 | 90μl |
| KP515 | 90μl |
| KP516 | 90μl |
| i7 PCR Primer | Specification |
| KP713 | 60μl |
| KP714 | 60μl |
| KP715 | 60μl |
| KP716 | 60μl |
| KP717 | 60μl |
| KP718 | 60μl |
| KP719 | 60μl |
| KP720 | 60μl |
| KP721 | 60μl |
| KP722 | 60μl |
| KP723 | 60μl |
| KP724 | 60μl |
Sequence Information
Adapter:
5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’
5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’
i5 PCR Primer:
5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT
C-3’
i7 PCR Primer:
5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’


GDSBio is a high-tech company focused on the development, production and marketing of quality life science products. The company has a complete product line, with PCR technology as the core, focusing on ordinary PCR, fluorescent quantitative PCR, NGS library construction, nucleic acid electrophoresis and other molecular biology technologies, and has developed molecular scientific research reagents, molecular in vitro diagnostic raw materials, nucleic acid extraction and detection reagents and other products.

|
|
Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B Images |