Home > NGS Library Construction >

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Product Categories

PCR Master Mix [90]
Real Time PCR Mix [39]
One Step RT QPCR Master Mix [40]
NGS Library Construction [97]
Nucleic Acid Extraction Kit [7]
DNA Marker Electrophoresis [63]
Nucleic Acid Gel Stain [8]
DNA Electrophoresis Buffer [25]
Reverse Transcriptase PCR Reagents [42]
Silica Spin Column [6]
In Vitro Diagnostic Products [12]
Molecular Tool Enzyme [30]
BlackBerry Replacement Housing [1]

Guangzhou Dongsheng Biotech Co., Ltd

Contact Now

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Name: Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002A
Brand: GDSBio
Price: 1 USD

Quality Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A for sale

Brand Name : GDSBio

Model Number : K002-A

Certification : ISO9001, ISO13485

Place of Origin : China

MOQ : 1 Box

Payment Terms : L/C, D/A, D/P, T/T, Western Union, MoneyGram

Supply Ability : 10000 Box per Day

Delivery Time : 8 work days

Packaging Details : small package or bulk distribute or OEM

Cat. No. : K002-A

Specification : 192 rxns

Appearance : Complete, no damage

Stock : yes

Logo Printing : With Logo Printing

Transport Package : Packing

Shelf Life : 12 months

Storage Conditions : Stored at -20°C

Contact Now

Multiplex Oligos 1 for Illumina

【Product Name】

Multiplex Oligos 1 for Illumina

【Cat. No./Spec.】

K002-A/192 rxns

【Product Description】

#K002-A Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-B Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.

【Storage Condition & Shelf Life】

All reagents should be stored at -20°C. The product is valid for 12 months.

Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.

【Scope of application】

This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.

Sequence Information

Adapter:

5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’

i5 PCR Primer:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT

C-3’

i7 PCR Primer:

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Product Tags:

PCR Primers Multiplex Oligos 1

Universal Adapter Multiplex Oligos 1

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A Images

Inquiry Cart 0

Send your message to this supplier


*From:	Your email address is incorrect!
*To:	Guangzhou Dongsheng Biotech Co., Ltd
*Subject:	Subject is empty!
*Message:	For the best results, we recommend including the following details: -Self introduction -Required specifications -Inquire about price/MOQ Characters Remaining: (0/3000) Please enter 20 to 3000 characters to contact this supplier!